ID: 1036645849_1036645859

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1036645849 1036645859
Species Human (GRCh38) Human (GRCh38)
Location 8:10611214-10611236 8:10611257-10611279
Sequence CCAGCCATTCGCGGACCACAGCC AGAGCTGGGTGACACACCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101} {0: 1, 1: 0, 2: 0, 3: 14, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!