ID: 1036651828_1036651830

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1036651828 1036651830
Species Human (GRCh38) Human (GRCh38)
Location 8:10649098-10649120 8:10649113-10649135
Sequence CCTTCCTTAGAAAATTCCCGGAT TCCCGGATTCACCACTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 93} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!