ID: 1036664539_1036664548

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1036664539 1036664548
Species Human (GRCh38) Human (GRCh38)
Location 8:10730274-10730296 8:10730309-10730331
Sequence CCATGAAGGCGTTCATGGGCCGC TCGGAGCCCTTGTCCCCCGGGGG
Strand - +
Off-target summary {0: 6, 1: 6, 2: 3, 3: 5, 4: 48} {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!