ID: 1036665892_1036665903

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1036665892 1036665903
Species Human (GRCh38) Human (GRCh38)
Location 8:10738110-10738132 8:10738156-10738178
Sequence CCCTGATCATTGTCTGGAGAAGG GGGGAACTAAAACAGAAACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 29, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!