ID: 1036668886_1036668896

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1036668886 1036668896
Species Human (GRCh38) Human (GRCh38)
Location 8:10766556-10766578 8:10766580-10766602
Sequence CCCTGAACCAACAGGCCAGCTTG GGGCTTCTTTCCCTCAGCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!