ID: 1036686306_1036686317

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1036686306 1036686317
Species Human (GRCh38) Human (GRCh38)
Location 8:10913938-10913960 8:10913990-10914012
Sequence CCAGCAGCAGGGCTTGGCAGCCT GACTCTCCTTTGGTCAGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 298} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!