ID: 1036723729_1036723736

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1036723729 1036723736
Species Human (GRCh38) Human (GRCh38)
Location 8:11201069-11201091 8:11201091-11201113
Sequence CCCCGTCGGCGGCGGCGCTGCGG GCGCGGCTTCCTGCCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 213} {0: 1, 1: 0, 2: 1, 3: 12, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!