ID: 1036723924_1036723936

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1036723924 1036723936
Species Human (GRCh38) Human (GRCh38)
Location 8:11201695-11201717 8:11201735-11201757
Sequence CCCTCGGCGTTTCAGAATCCGGC TCCAAAGTGATCCCTGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 23} {0: 1, 1: 0, 2: 2, 3: 13, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!