ID: 1036733282_1036733294

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1036733282 1036733294
Species Human (GRCh38) Human (GRCh38)
Location 8:11284727-11284749 8:11284752-11284774
Sequence CCTCGCCGCGCCCACCCAGCCTG GCGGGCCCAGCCTCACCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 63, 4: 475} {0: 1, 1: 1, 2: 1, 3: 24, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!