ID: 1036751351_1036751359

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1036751351 1036751359
Species Human (GRCh38) Human (GRCh38)
Location 8:11445402-11445424 8:11445451-11445473
Sequence CCAAGAACAACACCTTACCTCAC CTGCAGCTGTGGAGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 147} {0: 1, 1: 1, 2: 4, 3: 69, 4: 563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!