ID: 1036767920_1036767932

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1036767920 1036767932
Species Human (GRCh38) Human (GRCh38)
Location 8:11560674-11560696 8:11560709-11560731
Sequence CCTCTGTCCACCTGGATCTGCCA TGCCCCCACGGGGCAGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 303} {0: 1, 1: 0, 2: 2, 3: 19, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!