ID: 1036768918_1036768928

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1036768918 1036768928
Species Human (GRCh38) Human (GRCh38)
Location 8:11565720-11565742 8:11565751-11565773
Sequence CCGTGGGCAAGCACTGGATGGGA CTTTAAGGAGGTCTGGGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!