ID: 1036769226_1036769233

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1036769226 1036769233
Species Human (GRCh38) Human (GRCh38)
Location 8:11567208-11567230 8:11567237-11567259
Sequence CCGGCTTGGTTTTCCTGGGAAAG CTGGAGATCTTGAAGGATGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 19, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!