ID: 1036770412_1036770420

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1036770412 1036770420
Species Human (GRCh38) Human (GRCh38)
Location 8:11575020-11575042 8:11575044-11575066
Sequence CCATCACCGCTTATCGTCCCTGT CCTGTGCCAGAGAGGCTGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!