ID: 1036814377_1036814383

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1036814377 1036814383
Species Human (GRCh38) Human (GRCh38)
Location 8:11890337-11890359 8:11890360-11890382
Sequence CCCATGTGTCGTGGGAGGAACCT GGTGGGCAGTGATTGAATAATGG
Strand - +
Off-target summary {0: 13, 1: 201, 2: 1450, 3: 4003, 4: 6657} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!