ID: 1036849865_1036849873

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1036849865 1036849873
Species Human (GRCh38) Human (GRCh38)
Location 8:12194047-12194069 8:12194077-12194099
Sequence CCCCGCGTTCTCCTCGGGCGCCA GGCGAGGCCGCAGCCGTTGCCGG
Strand - +
Off-target summary {0: 6, 1: 4, 2: 0, 3: 3, 4: 48} {0: 2, 1: 0, 2: 0, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!