ID: 1036862265_1036862273

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1036862265 1036862273
Species Human (GRCh38) Human (GRCh38)
Location 8:12363155-12363177 8:12363201-12363223
Sequence CCTGGAGTAGGTAGGTTGCCAAG AGTCTTTTCTGGGCCAACAAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 6, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!