ID: 1036871229_1036871241

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1036871229 1036871241
Species Human (GRCh38) Human (GRCh38)
Location 8:12436320-12436342 8:12436362-12436384
Sequence CCCCGCGTTCTCCTCGGGCGCCA GCCGTTGCCGGGAGACCTGGAGG
Strand - +
Off-target summary {0: 6, 1: 4, 2: 0, 3: 3, 4: 48} {0: 2, 1: 0, 2: 2, 3: 17, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!