ID: 1036964512_1036964515

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1036964512 1036964515
Species Human (GRCh38) Human (GRCh38)
Location 8:13280975-13280997 8:13280998-13281020
Sequence CCCTAAAATGCTGTAACTCCACA GAAGATCTTCTCCACTGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 203} {0: 1, 1: 1, 2: 5, 3: 26, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!