|
Left Crispr |
Right Crispr |
| Crispr ID |
1037199148 |
1037199151 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:16229519-16229541
|
8:16229536-16229558
|
| Sequence |
CCATAGGATGACACAGCAAGAAG |
AAGAAGGCCCCCACCAGGTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 89, 2: 311, 3: 1232, 4: 2541} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|