ID: 1037211994_1037211999

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1037211994 1037211999
Species Human (GRCh38) Human (GRCh38)
Location 8:16400056-16400078 8:16400074-16400096
Sequence CCCACACTGTTGGAGGTAGGATC GGATCTGGTGGCAAGTGTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 23, 3: 182, 4: 972}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!