ID: 1037258252_1037258257

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1037258252 1037258257
Species Human (GRCh38) Human (GRCh38)
Location 8:16979473-16979495 8:16979501-16979523
Sequence CCCCTGACCGGGGCTGCTGCCTT CAGAGATGCCCTGCCCAGAGAGG
Strand - +
Off-target summary No data {0: 479, 1: 657, 2: 479, 3: 561, 4: 1274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!