ID: 1037262849_1037262864

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1037262849 1037262864
Species Human (GRCh38) Human (GRCh38)
Location 8:17027358-17027380 8:17027405-17027427
Sequence CCGTGGGGGCGGCCTGCGGTGAC CTTCTCCTCCCGAGAGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114} {0: 1, 1: 0, 2: 1, 3: 14, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!