ID: 1037282457_1037282459

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1037282457 1037282459
Species Human (GRCh38) Human (GRCh38)
Location 8:17257414-17257436 8:17257438-17257460
Sequence CCATATAAATATTAGGATTATGA CAGTGAAAACACATGGATACAGG
Strand - +
Off-target summary No data {0: 1, 1: 36, 2: 1391, 3: 16663, 4: 17544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!