ID: 1037299379_1037299387

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1037299379 1037299387
Species Human (GRCh38) Human (GRCh38)
Location 8:17435048-17435070 8:17435089-17435111
Sequence CCCAACATCTGGCATTCAGCTGT CACCCTTGGGGGTTTCTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 197} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!