ID: 1037318409_1037318413

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1037318409 1037318413
Species Human (GRCh38) Human (GRCh38)
Location 8:17621095-17621117 8:17621124-17621146
Sequence CCACCTCGGCAGACACAGGTGAA TGCTGGGTGCAGCTCTGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104} {0: 1, 1: 0, 2: 2, 3: 28, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!