ID: 1037360473_1037360479

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1037360473 1037360479
Species Human (GRCh38) Human (GRCh38)
Location 8:18068720-18068742 8:18068770-18068792
Sequence CCGGGCATCCTGAGCTGCTAAAC AAAAAAGAGACACCCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113} {0: 2, 1: 0, 2: 2, 3: 18, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!