ID: 1037360474_1037360480

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1037360474 1037360480
Species Human (GRCh38) Human (GRCh38)
Location 8:18068728-18068750 8:18068774-18068796
Sequence CCTGAGCTGCTAAACATCCTGCA AAGAGACACCCACCCCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 170} {0: 2, 1: 0, 2: 2, 3: 29, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!