ID: 1037360476_1037360484

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1037360476 1037360484
Species Human (GRCh38) Human (GRCh38)
Location 8:18068764-18068786 8:18068783-18068805
Sequence CCCCACAAAAAAGAGACACCCAC CCACCCCAGGCCGGGCATCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 24, 4: 295} {0: 1, 1: 0, 2: 1, 3: 31, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!