ID: 1037412793_1037412795

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1037412793 1037412795
Species Human (GRCh38) Human (GRCh38)
Location 8:18616102-18616124 8:18616123-18616145
Sequence CCTCATTACAGGGCGAGGGCTCT CTGGCTTACCACTCACGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!