|
Left Crispr |
Right Crispr |
| Crispr ID |
1037415012 |
1037415016 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:18640518-18640540
|
8:18640551-18640573
|
| Sequence |
CCCTTCACCTTCACTTGGCTCTC |
TTCCTGCCACCATGTGAAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 190, 1: 1080, 2: 1867, 3: 2451, 4: 2170} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|