ID: 1037415012_1037415016

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1037415012 1037415016
Species Human (GRCh38) Human (GRCh38)
Location 8:18640518-18640540 8:18640551-18640573
Sequence CCCTTCACCTTCACTTGGCTCTC TTCCTGCCACCATGTGAAGAAGG
Strand - +
Off-target summary No data {0: 190, 1: 1080, 2: 1867, 3: 2451, 4: 2170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!