ID: 1037556100_1037556102

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1037556100 1037556102
Species Human (GRCh38) Human (GRCh38)
Location 8:20024051-20024073 8:20024075-20024097
Sequence CCCAGCTGACGTCTTGACTACAG CTCATAAGATACCCTGAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!