ID: 1037598595_1037598608

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1037598595 1037598608
Species Human (GRCh38) Human (GRCh38)
Location 8:20374659-20374681 8:20374706-20374728
Sequence CCTGCCTCCTTCTCCCTGCTCTC CCACAATCCCCTTTGGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 217, 4: 1692} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!