ID: 1037687952_1037687959

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1037687952 1037687959
Species Human (GRCh38) Human (GRCh38)
Location 8:21159498-21159520 8:21159533-21159555
Sequence CCAGAAAGGAGGCCTTTGAAGAA CAGAATAAAGAGAGGGAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!