ID: 1037711222_1037711227

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1037711222 1037711227
Species Human (GRCh38) Human (GRCh38)
Location 8:21356935-21356957 8:21356964-21356986
Sequence CCTCCCACAATGTGTGGGAATTA CTACAATTCAAGATGAGATATGG
Strand - +
Off-target summary No data {0: 39, 1: 4250, 2: 7406, 3: 9085, 4: 9114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!