ID: 1037727395_1037727401

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1037727395 1037727401
Species Human (GRCh38) Human (GRCh38)
Location 8:21494380-21494402 8:21494426-21494448
Sequence CCCTCTCAAGATTCTCTTCTGCT AGGTGGGCCCCTTTTTCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 352} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!