ID: 1037753062_1037753066

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1037753062 1037753066
Species Human (GRCh38) Human (GRCh38)
Location 8:21695231-21695253 8:21695257-21695279
Sequence CCAGAGGGCGCACATGATGAACG CTCTGTTATCATCACTGTAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!