ID: 1037754081_1037754090

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1037754081 1037754090
Species Human (GRCh38) Human (GRCh38)
Location 8:21700312-21700334 8:21700329-21700351
Sequence CCACAGAGCCCCAGGGAGGCAGG GGCAGGGCTGCCCAGAGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 132, 4: 697} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!