ID: 1037762489_1037762497

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1037762489 1037762497
Species Human (GRCh38) Human (GRCh38)
Location 8:21751109-21751131 8:21751160-21751182
Sequence CCTAAAGCTGTGGTGAGGAGTAA CTTAGGAAGCAGCTGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 250} {0: 1, 1: 0, 2: 1, 3: 25, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!