ID: 1037779306_1037779311

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1037779306 1037779311
Species Human (GRCh38) Human (GRCh38)
Location 8:21856751-21856773 8:21856766-21856788
Sequence CCTTTTGACAGAATTCATCCTCA CATCCTCAAGCGAAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 235} {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!