ID: 1037803861_1037803870

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1037803861 1037803870
Species Human (GRCh38) Human (GRCh38)
Location 8:22049009-22049031 8:22049049-22049071
Sequence CCTGGGCTCGCGCGGCGCGGCCC AGAAAACCCGAGCCCCCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 308} {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!