ID: 1037803907_1037803918

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1037803907 1037803918
Species Human (GRCh38) Human (GRCh38)
Location 8:22049123-22049145 8:22049150-22049172
Sequence CCAGGCCCGAGGCGCAGGCGAGG TGCGGAGCCCGGCGGAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 212} {0: 1, 1: 0, 2: 5, 3: 30, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!