ID: 1037811579_1037811582

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1037811579 1037811582
Species Human (GRCh38) Human (GRCh38)
Location 8:22089704-22089726 8:22089725-22089747
Sequence CCGCCTCGCCTGGGCTTGAAAAA AAATCGCCGTCCCTTCCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 59, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!