ID: 1037811583_1037811589

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1037811583 1037811589
Species Human (GRCh38) Human (GRCh38)
Location 8:22089731-22089753 8:22089749-22089771
Sequence CCGTCCCTTCCCCTCGGTCTGAT CTGATCTCCCAGACAACTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 16, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!