ID: 1037811585_1037811598

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1037811585 1037811598
Species Human (GRCh38) Human (GRCh38)
Location 8:22089736-22089758 8:22089788-22089810
Sequence CCTTCCCCTCGGTCTGATCTCCC GGACGCCCTTCCCGTCACCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!