ID: 1037811586_1037811594

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1037811586 1037811594
Species Human (GRCh38) Human (GRCh38)
Location 8:22089740-22089762 8:22089761-22089783
Sequence CCCCTCGGTCTGATCTCCCAGAC ACAACTCCAGGACCTTGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!