ID: 1037813279_1037813289

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1037813279 1037813289
Species Human (GRCh38) Human (GRCh38)
Location 8:22098934-22098956 8:22098969-22098991
Sequence CCCTCTTCCTTCAGGTTACCCAG TGAGGCTTCCTTCCCTGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 277} {0: 1, 1: 1, 2: 4, 3: 29, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!