ID: 1037819454_1037819464

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1037819454 1037819464
Species Human (GRCh38) Human (GRCh38)
Location 8:22128714-22128736 8:22128747-22128769
Sequence CCAGGATCTTGGTCTCCAGAAGG GCCAGGGCCGGAAGGCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 183} {0: 1, 1: 0, 2: 1, 3: 20, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!