ID: 1037819978_1037819991

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1037819978 1037819991
Species Human (GRCh38) Human (GRCh38)
Location 8:22130796-22130818 8:22130829-22130851
Sequence CCGGGGGGAACACGCGCCCCGGG CCGAGTTGGGGGAAAGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103} {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!