ID: 1037820082_1037820101

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1037820082 1037820101
Species Human (GRCh38) Human (GRCh38)
Location 8:22131170-22131192 8:22131206-22131228
Sequence CCCTTTGTTCCCCCTCCCCCCCG CCTGCCGAGAGAGGCTCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 39, 4: 518} {0: 1, 1: 0, 2: 1, 3: 21, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!